6 22 2015 CARM1 qPCR

Today I ran a qPCR for CARM1 using cDNA created by Sam last week. On friday Steven got the initial run of sequenced samples to check that all populations produced the same sequence. He selected CARM1 as being the most similar with the other primers having one issue or another. I put together a qPCR plate with all the cDNA samples to see how CARM1 differs between populations and treatment/control.

Primer Used:

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

qPCR Master Mix Reagent Table:

	Volume	Reactions X55
Ssofast Evagreen MM	10	550
FWD Primer	0.5	27.5
REV Primer	0.5	27.5
Nuclease Free H2O	8	440
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
1. Due to pipette error only 3 NTCs were run
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Sybr New Plate+Sybr cDNA 60 melt 2 Read
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

HC1-8 Amplification

 HC1-8 Melt Curve

NC1-8 Amplification

 NC1-8 Melt Curve

SC1-8 Amplification

 SC1-8 Melt Curve

HT1-8 Amplification

 HT1-8 Melt Curve

NT1-8 Amplification

 NT1-8 Melt Curve

ST1-8 Amplification

 ST1-8 Melt Curve

NTC 1-3 Amplification

 NTC 1-3 Melt Curve

As you can see there is good amplification amoung all samples but without running the data through PCR Miner I can't distinguish a difference. Also there was some amplification in the NTC but it appears to be nonspecific with a much higher melting temp than the actual products. These high temp amplifiers don't appear in any of the other samples so I'm not worried about them as possible contamination. I've run a PCR on some more flanking primers to have them sequenced and am running a qPCR for Actin to see if we have similar results.

You can see the raw data file here.

5 8 2015 cDNA creation and Primer Check

On Friday I created cDNA using a complicated system calculate concentration and volume of RNA needed to produce equivalent concentrations of cDNA across the board.

First I need to get updated concentrations on all the RNA samples to calculate the volume needed for cDNA creation.

Sample ID	Date	ng/ul	A260	A280	260/280	260/230
42715ST1	5/8/2015	385.82	9.646	5.076	1.9	0.94
42715ST2	5/8/2015	287.1	7.178	3.929	1.83	0.71
42715ST3	5/8/2015	267.75	6.694	3.623	1.85	0.89
42715ST4	5/8/2015	322.48	8.062	4.324	1.86	0.77
42715ST5	5/8/2015	244.87	6.122	3.424	1.79	0.66
42715HT1	5/8/2015	172.11	4.303	2.502	1.72	0.57
42715HT2	5/8/2015	323.01	8.075	4.359	1.85	0.75
42715HT3	5/8/2015	141.12	3.528	1.808	1.95	1.5
42715HT4	5/8/2015	177.02	4.425	2.597	1.7	0.59
42715HT5	5/8/2015	294.26	7.357	4.019	1.83	0.72
42815SM1	5/8/2015	110.13	2.753	1.482	1.86	0.96
42815SM2	5/8/2015	43.08	1.077	0.624	1.73	0.57
42815SM3	5/8/2015	38.87	0.972	0.638	1.52	0.42
42815SM4	5/8/2015	112.83	2.821	1.738	1.62	0.42
42815SM5	5/8/2015	67.16	1.679	1.047	1.6	0.36
42815HM1	5/8/2015	52.7	1.318	0.758	1.74	0.75
42815HM2	5/8/2015	72.28	1.807	1.202	1.5	0.35
42815HM3	5/8/2015	59.05	1.476	1.043	1.42	0.26
42815HM4	5/8/2015	82.5	2.062	1.27	1.62	0.34
42815HM5	5/8/2015	128.42	3.21	1.911	1.68	0.4

Per Sam's instructions on the genefish wiki:

1. Use as much RNA as possible (up to 1ug); max volume of RNA = 17.75uL. Generally, identify the RNA sample with the lowest concentration and multiply by 17.75uL. Use this quantity (ug) of RNA for each and every sample.
2. Transfer calculated volume(s) of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
3. Add appropriate amount of primer to sample. Use 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT Cat#C1101 in this example). Total volume (RNA + primers) should equal 18.25uL.

Sample SM3 was the lowest concentration on the table. To use a max of 17.75 ul of RNA I could only produce 690 ng of RNA with SM3. I set the bar to 690 ng and made the following calculations of RNA, Water, and Primer needed. SM2 and SM3 still ended up producing a volume larger than desired due to me having to use a 1:10 dilution of primer to account for the less than optimum concentration of RNA.  Instead of using the standard 0.5 ul of oligo Primer, I used 0.345 which I diluted in a 1:10 ratio. For the 1:10 dilution I added 7.6 ul of oligo primer to 76 ul of water to generation 22 reactions worth of primer. 

Sample ID	ng/ul	ul RNA for 690 ng	ul h20 for 17.90	1:10 primer ul	total volume
42715ST1	385.82	1.79	13.01	3.45	18.25
42715ST2	287.1	2.40	12.39	3.45	18.25
42715ST3	267.75	2.58	12.22	3.45	18.25
42715ST4	322.48	2.14	12.66	3.45	18.25
42715ST5	244.87	2.82	11.98	3.45	18.25
42715HT1	172.11	4.01	10.79	3.45	18.25
42715HT2	323.01	2.14	12.66	3.45	18.25
42715HT3	141.12	4.89	9.91	3.45	18.25
42715HT4	177.02	3.90	10.90	3.45	18.25
42715HT5	294.26	2.34	12.45	3.45	18.25
42815SM1	110.13	6.27	8.53	3.45	18.25
42815SM2	43.08	16.02	0.00	3.45	19.47
42815SM3	38.87	17.75	0.00	3.45	21.20
42815SM4	112.83	6.12	8.68	3.45	18.25
42815SM5	67.16	10.27	4.52	3.45	18.25
42815HM1	52.7	13.09	1.70	3.45	18.25
42815HM2	72.28	9.55	5.25	3.45	18.25
42815HM3	59.05	11.69	3.11	3.45	18.25
42815HM4	82.5	8.36	6.43	3.45	18.25
42815HM5	128.42	5.37	9.42	3.45	18.25

1. Added the water first

2. Added the RNA

3. Added the primer to each reaction tube. 

4. Incubated in the Thermocycler for 5 minutes at 70 C

5. Immediately transferred to ice after completion. 

Then I made up the reverse transcriptase master mix:

Reagents	Volume ul	Reactions X22
M-MLV RT Buffer	5	110
10 mM dNTPs	1.25	27.5
M-MLV RT	0.345	7.59
H20	0.155	3.41
Total Volume	6.75	148.5

1.Added 6.75 ul of the master mix to each tube. 

2. Ran the following program on the thermocycler.

Amplify	42 C	1 hr
Inactivate	95 C	3 min

During the program run I picked up the new primers from the science depot in the med school. 

I rehydrated the primer stock with Nanopure H20 since no TE was available. I determined the rehydration volume based on the nanoMolar concentrations. I then made working stock from these rehydrated stocks using a 1:10 dilution of 10 ul primer to 90 ul Nanopure H20. 

Once the cDNA amplification was complete I ran a Primer/cDNA check using a qPCR and all the primers we are using for 310 lab. 

Primers:

Superoxide dismutase (SD)

Glutamine synthetase (GS)

Citrate synthase (CS)

HSP70 (HSP)

Actin (ACT)

I made a Master Mix for 6 reactions for each of the 5 primers. 

	Volume	Reactions X6
Ssofast Evagreen MM	10	60
FWD Primer	0.5	3
REV Primer	0.5	3
Nuclease Free H2O	8	48

I ran a template control and a positive control (Fidalgo seed oysters extracted on 3/23/2015 with a concentration of 167.3 ng/ul) for each primer as well as 4 cDNA samples I produced. 

Plate layout:

8	9	10	11	12
SD	GS	CS	HSP	ACT
C-	C-	C-	C-	C-
C+	C+	C+	C+	C+
42715ST1	42715HT1	42715SM1	42715HM1	42715ST5
42715ST2	42715HT2	42715SM2	42715HM2	42715HT5
42715ST3	42715HT3	42715SM3	42715HM3	42715SM5
42715ST4	42715HT4	42715SM4	42715HM4	42715HM5

I ran the following program:

Sybr New Plate+Sybr cDNA 55 melt 2
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	15 sec
	55 C	15 sec
Read
	72 C	15 sec
Read
Repeat Elongation 40 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	65 - 95 C	30 sec
	21 C	10 min
End

You can see the amplification curves below:

Melt Curves:

The 3 melt curve peaks correlate with HSP70, Actin, and Glutamine synthetase primers working with the cDNA. The Superoxide dismutase and the citrate synthase primers did not work for the cDNA. 

You can see the raw qPCR data here.

Moving forward, the 310 students will be running their samples using the primers today and tomorrow. I'll update the notebook with their data and some graphs to hopefully produce some interesting info about stress resilience mechanisms in the olys.